Review



algorithms cellranger suite  (10X Genomics)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    10X Genomics algorithms cellranger suite
    Algorithms Cellranger Suite, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+cellranger/10x+cellranger+genomics+suite/pm42167232-241-47-51
    Average 86 stars, based on 1 article reviews
    algorithms cellranger suite - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    other:

    Article Title: Molecular anatomy of adult mouse leptomeninges.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LAS X software (3.5.723225) Leica https://www.leica-microsystems.com/ products/microscope-software/p/ leica-las-x-ls/downloads/ Other Online database: Adult leptomeningeal droplet scRNASeq data This paper http://betsholtzlab.org/Publications/BrainFB/ meninges/database.html Online database: Adult dural droplet scRNASeq data This paper http://betsholtzlab.org/Publications/BrainFB/ dural/database.html Online database: Adult brain vascular fragment droplet ScRNASeq data This paper http://betsholtzlab.org/Publications/BrainFB/ VascularStubs/database.html Online database: Adult brain FACS-SmartSeq2 data This paper http://betsholtzlab.org/Publications/ MouseBrainFB/search.html Online database: Adolescent brain fibroblast droplet scRNASeq data Zeisel et al.29 http://betsholtzlab.org/Publications/ BrainFB/Adolescent/FB.html Online database: Embryonic brain fibroblast droplet scRNASeq data La Manno et al.14 http://betsholtzlab.org/Publications/ BrainFB/Dev/search.html

    Single Cell:

    Article Title: Lineage skewing and genome instability underlie marrow failure in a zebrafish model of GATA2 deficiency.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies H2A.XS139ph GeneTex GTX127342; RRID:AB_2833105 Alexa Fluor 594 goat anti-rabbit Invitrogen A11012; RRID:AB_2534079 gH2AX Millipore 05-636; RRID:AB_309864 H2A Millipore 07-146; RRID:AB_310394 GATA2 R&D Systems MAB2046-SP; RRID:AB_2108424 Anti-rabbit HRP Agilent P0399; RRID:AB_2617141 Anti-goat HRP Agilent P0449; RRID:AB_2617143 Anti-Mouse HRP Agilent P0447; RRID:AB_2617137 Anti-Digoxigenin-AP Roche 11093274910; RRID:AB_514497 Chemicals, peptides, and recombinant proteins StemPro-34 SFM Invitrogen 10639011 Pen/Strep Gibco 15140122 L-glutamine Gibco 25030081 SCF Peprotech 250-03 pan-GATA inhibitor pyrrothiogatain Generon AOB13027-5 NPM1 oligomerization inhibitor NSC348884 Selleck Chemicals S8149-SEL superfrost plus slide Thermo Scientific 12372098 May-Gr€unwald Sigma MG500 Giemsa stain, modified solution Sigma-Aldrich 48900-1L-F DPX Sigma-Aldrich 44581 trypan blue Sigma-Aldrich T6146 FCS Gibco 26140079 Hoechst’s Invitrogen 11534886 PFA Thermo Scientific 28908 Triton Alfa Aesar A16046 NaCl Sigma 101856436 MgCl2 Sigma 102111007 sucrose Sigma 102192646 PIPES Alfa Aesar J63234 DAPI abcam ab104139 DraIII NEB R3510 mMESSAGE mMACHINETM T7 Transcription Kit Thermofisher AM1344 TE buffer (Tris-HCL and EDTA) Trizma base EDTA Sigma-Aldrich Sigma-Aldrich T1503 E6758 Ethanol VWR 20821 20x SSC BioRad 1610775 BM Purple AP Stain Roche 11442074001 Blocking Reagent Roche 11096176001 Formamide VWR 24311.291 Tween 20 Sigma-Aldrich P2287 Sodium Chloride J.T.Baker 15368426 Maleic Acid Sigma-Aldrich M0375 Magnesium Chloride Sigma-Aldrich M9272 Hydrogen Peroxide J.T.Baker 15587984 (Continued on next page) 16 Cell Reports 42, 112571, June 27, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 10x PBS Gibco 14200-067 Citric Acid Sigma-Aldrich C0759 Torula RNA Sigma-Aldrich R6875 Heparin Sigma-Aldrich H3400 DMSO Sigma-Aldrich D2650 Tricaine Sigma-Aldrich E10521 Methylcellulose Sigma-Aldrich M0387 Deposited data RAW and analyzed data This paper GEO: GSE200503 scRNA-Seq: Single-cell RNA-seq reveals a distinct transcriptome signature of hematopoiesis in GATA2 deficiency Wu et al.32 GEO: GSE135194 Gata2a ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayex press Cebpa ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayexpress DnaseI ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayexpress Gata2 ChIP-Seq Sanchéz-Castillo et al.34 GEO:GSM552234 https://www.ncbi.nlm.nih.gov/geo/ H3K27AC ChIPseq Sanchéz-Castillo et al.34 GEO:GSM1329815 https://www.ncbi.nlm.nih.gov/geo/ H3K4me1 ChIp-Seq Sanchéz-Castillo et al.34 GEO:GSE47085 https://www.ncbi.nlm.nih.gov/geo/ Analysis code This study https://zenodo.org/badge/latestdoi/595093929 Experimental models: Cell lines HPC-7 Pinto do Ó et al.48 RRID:CVCL_RB19 Experimental models: Organisms/strains zebrafish Tg(-6.0itga2b:EGFP)la2Tg Li et al.63 N/A Zebrafish Tg(gata1a:DsRed)sd2Tg Traver et al.64 N/A Zebrafish Tg(mpx:GFP)c264Tg Renshaw et al.15 N/A Zebrafish Tg(mpeg1:GFP)gl22 Ellet et al.65 N/A Zebrafish gata2aDi4/Di4 Dobrzycki et al.13 N/A Zebrafish Tg(runx1P2:Citrine)ox1Tg Bonkhofer et al.45 N/A Recombinant DNA GATA2 ORF plasmid Genscript OMu19368D Software and algorithms CellRanger (v3.1.0) 10x Genomics https://www.10xgenomics.com/ Loupe(v6.0) 10x Genomics https://www.10xgenomics.com/; RRID:SCR_018555 Seurat (v4.04) Butler et al.66; Satija et al.67; Stuart et al.68 https://satijalab.org/seurat/index.html; RRID:SCR_007322 Metascape Zhou et al.69 https://metascape.org/gp/index.html Monocle3 Cao et al.70; Levine et al.71; Qiu et al.72; Traag et al.73; Trapnell et al.74 https://cole-trapnell-lab.github.io/monocle3/; RRID:SCR_018685 MACS3 https://github.com/macs3-project/MACS CellRanger ATAC (v1.2.0) 10xGenomics https://www.10xgenomics.com/ Signac (v1.4.0) Stuart et al.75 https://stuartlab.org/signac/; RRID:SCR_021158 (Continued on next page) Cell Reports 42, 112571, June 27, 2023 17 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER HOMER (v4.4) Heinz et al.76 http://homer.ucsd.edu/homer/; RRID:SCR_010881 Java TreeView Saldanha77 https://jtreeview.sourceforge.net/; RRID:SCR_016916 Fiji Schindelin et al.78 https://imagej.net/software/fiji/; RRID:SCR_002285 GraphPad Prism (v9.0) GraphPad software https://www.graphpad.com/ AxioVision software Zeiss https://www.micro-shop.zeiss.com/ en/us/system/axiovision+softwaresoftware+axiovision-software/6014/ Other ISH probe: runx1 Kalev-Zylinska79 N/A ISH probe: mpx Bennett et al.80 N/A ISH probe: cebpa Liu et al.81 N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AA) Sequence: ATAGCCAAGCTTCCCGAAG IDT N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AB Sequence: GAACACATCCACCTCGTCCG IDT N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AC) Sequence: TCTGGTGATACGTCTTTCGG IDT N/A Cas9 protein (Alt-R S.p.

    RNA Sequencing:

    Article Title: Lineage skewing and genome instability underlie marrow failure in a zebrafish model of GATA2 deficiency.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies H2A.XS139ph GeneTex GTX127342; RRID:AB_2833105 Alexa Fluor 594 goat anti-rabbit Invitrogen A11012; RRID:AB_2534079 gH2AX Millipore 05-636; RRID:AB_309864 H2A Millipore 07-146; RRID:AB_310394 GATA2 R&D Systems MAB2046-SP; RRID:AB_2108424 Anti-rabbit HRP Agilent P0399; RRID:AB_2617141 Anti-goat HRP Agilent P0449; RRID:AB_2617143 Anti-Mouse HRP Agilent P0447; RRID:AB_2617137 Anti-Digoxigenin-AP Roche 11093274910; RRID:AB_514497 Chemicals, peptides, and recombinant proteins StemPro-34 SFM Invitrogen 10639011 Pen/Strep Gibco 15140122 L-glutamine Gibco 25030081 SCF Peprotech 250-03 pan-GATA inhibitor pyrrothiogatain Generon AOB13027-5 NPM1 oligomerization inhibitor NSC348884 Selleck Chemicals S8149-SEL superfrost plus slide Thermo Scientific 12372098 May-Gr€unwald Sigma MG500 Giemsa stain, modified solution Sigma-Aldrich 48900-1L-F DPX Sigma-Aldrich 44581 trypan blue Sigma-Aldrich T6146 FCS Gibco 26140079 Hoechst’s Invitrogen 11534886 PFA Thermo Scientific 28908 Triton Alfa Aesar A16046 NaCl Sigma 101856436 MgCl2 Sigma 102111007 sucrose Sigma 102192646 PIPES Alfa Aesar J63234 DAPI abcam ab104139 DraIII NEB R3510 mMESSAGE mMACHINETM T7 Transcription Kit Thermofisher AM1344 TE buffer (Tris-HCL and EDTA) Trizma base EDTA Sigma-Aldrich Sigma-Aldrich T1503 E6758 Ethanol VWR 20821 20x SSC BioRad 1610775 BM Purple AP Stain Roche 11442074001 Blocking Reagent Roche 11096176001 Formamide VWR 24311.291 Tween 20 Sigma-Aldrich P2287 Sodium Chloride J.T.Baker 15368426 Maleic Acid Sigma-Aldrich M0375 Magnesium Chloride Sigma-Aldrich M9272 Hydrogen Peroxide J.T.Baker 15587984 (Continued on next page) 16 Cell Reports 42, 112571, June 27, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 10x PBS Gibco 14200-067 Citric Acid Sigma-Aldrich C0759 Torula RNA Sigma-Aldrich R6875 Heparin Sigma-Aldrich H3400 DMSO Sigma-Aldrich D2650 Tricaine Sigma-Aldrich E10521 Methylcellulose Sigma-Aldrich M0387 Deposited data RAW and analyzed data This paper GEO: GSE200503 scRNA-Seq: Single-cell RNA-seq reveals a distinct transcriptome signature of hematopoiesis in GATA2 deficiency Wu et al.32 GEO: GSE135194 Gata2a ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayex press Cebpa ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayexpress DnaseI ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayexpress Gata2 ChIP-Seq Sanchéz-Castillo et al.34 GEO:GSM552234 https://www.ncbi.nlm.nih.gov/geo/ H3K27AC ChIPseq Sanchéz-Castillo et al.34 GEO:GSM1329815 https://www.ncbi.nlm.nih.gov/geo/ H3K4me1 ChIp-Seq Sanchéz-Castillo et al.34 GEO:GSE47085 https://www.ncbi.nlm.nih.gov/geo/ Analysis code This study https://zenodo.org/badge/latestdoi/595093929 Experimental models: Cell lines HPC-7 Pinto do Ó et al.48 RRID:CVCL_RB19 Experimental models: Organisms/strains zebrafish Tg(-6.0itga2b:EGFP)la2Tg Li et al.63 N/A Zebrafish Tg(gata1a:DsRed)sd2Tg Traver et al.64 N/A Zebrafish Tg(mpx:GFP)c264Tg Renshaw et al.15 N/A Zebrafish Tg(mpeg1:GFP)gl22 Ellet et al.65 N/A Zebrafish gata2aDi4/Di4 Dobrzycki et al.13 N/A Zebrafish Tg(runx1P2:Citrine)ox1Tg Bonkhofer et al.45 N/A Recombinant DNA GATA2 ORF plasmid Genscript OMu19368D Software and algorithms CellRanger (v3.1.0) 10x Genomics https://www.10xgenomics.com/ Loupe(v6.0) 10x Genomics https://www.10xgenomics.com/; RRID:SCR_018555 Seurat (v4.04) Butler et al.66; Satija et al.67; Stuart et al.68 https://satijalab.org/seurat/index.html; RRID:SCR_007322 Metascape Zhou et al.69 https://metascape.org/gp/index.html Monocle3 Cao et al.70; Levine et al.71; Qiu et al.72; Traag et al.73; Trapnell et al.74 https://cole-trapnell-lab.github.io/monocle3/; RRID:SCR_018685 MACS3 https://github.com/macs3-project/MACS CellRanger ATAC (v1.2.0) 10xGenomics https://www.10xgenomics.com/ Signac (v1.4.0) Stuart et al.75 https://stuartlab.org/signac/; RRID:SCR_021158 (Continued on next page) Cell Reports 42, 112571, June 27, 2023 17 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER HOMER (v4.4) Heinz et al.76 http://homer.ucsd.edu/homer/; RRID:SCR_010881 Java TreeView Saldanha77 https://jtreeview.sourceforge.net/; RRID:SCR_016916 Fiji Schindelin et al.78 https://imagej.net/software/fiji/; RRID:SCR_002285 GraphPad Prism (v9.0) GraphPad software https://www.graphpad.com/ AxioVision software Zeiss https://www.micro-shop.zeiss.com/ en/us/system/axiovision+softwaresoftware+axiovision-software/6014/ Other ISH probe: runx1 Kalev-Zylinska79 N/A ISH probe: mpx Bennett et al.80 N/A ISH probe: cebpa Liu et al.81 N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AA) Sequence: ATAGCCAAGCTTCCCGAAG IDT N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AB Sequence: GAACACATCCACCTCGTCCG IDT N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AC) Sequence: TCTGGTGATACGTCTTTCGG IDT N/A Cas9 protein (Alt-R S.p.

    Chromatin Immunoprecipitation:

    Article Title: Lineage skewing and genome instability underlie marrow failure in a zebrafish model of GATA2 deficiency.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies H2A.XS139ph GeneTex GTX127342; RRID:AB_2833105 Alexa Fluor 594 goat anti-rabbit Invitrogen A11012; RRID:AB_2534079 gH2AX Millipore 05-636; RRID:AB_309864 H2A Millipore 07-146; RRID:AB_310394 GATA2 R&D Systems MAB2046-SP; RRID:AB_2108424 Anti-rabbit HRP Agilent P0399; RRID:AB_2617141 Anti-goat HRP Agilent P0449; RRID:AB_2617143 Anti-Mouse HRP Agilent P0447; RRID:AB_2617137 Anti-Digoxigenin-AP Roche 11093274910; RRID:AB_514497 Chemicals, peptides, and recombinant proteins StemPro-34 SFM Invitrogen 10639011 Pen/Strep Gibco 15140122 L-glutamine Gibco 25030081 SCF Peprotech 250-03 pan-GATA inhibitor pyrrothiogatain Generon AOB13027-5 NPM1 oligomerization inhibitor NSC348884 Selleck Chemicals S8149-SEL superfrost plus slide Thermo Scientific 12372098 May-Gr€unwald Sigma MG500 Giemsa stain, modified solution Sigma-Aldrich 48900-1L-F DPX Sigma-Aldrich 44581 trypan blue Sigma-Aldrich T6146 FCS Gibco 26140079 Hoechst’s Invitrogen 11534886 PFA Thermo Scientific 28908 Triton Alfa Aesar A16046 NaCl Sigma 101856436 MgCl2 Sigma 102111007 sucrose Sigma 102192646 PIPES Alfa Aesar J63234 DAPI abcam ab104139 DraIII NEB R3510 mMESSAGE mMACHINETM T7 Transcription Kit Thermofisher AM1344 TE buffer (Tris-HCL and EDTA) Trizma base EDTA Sigma-Aldrich Sigma-Aldrich T1503 E6758 Ethanol VWR 20821 20x SSC BioRad 1610775 BM Purple AP Stain Roche 11442074001 Blocking Reagent Roche 11096176001 Formamide VWR 24311.291 Tween 20 Sigma-Aldrich P2287 Sodium Chloride J.T.Baker 15368426 Maleic Acid Sigma-Aldrich M0375 Magnesium Chloride Sigma-Aldrich M9272 Hydrogen Peroxide J.T.Baker 15587984 (Continued on next page) 16 Cell Reports 42, 112571, June 27, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 10x PBS Gibco 14200-067 Citric Acid Sigma-Aldrich C0759 Torula RNA Sigma-Aldrich R6875 Heparin Sigma-Aldrich H3400 DMSO Sigma-Aldrich D2650 Tricaine Sigma-Aldrich E10521 Methylcellulose Sigma-Aldrich M0387 Deposited data RAW and analyzed data This paper GEO: GSE200503 scRNA-Seq: Single-cell RNA-seq reveals a distinct transcriptome signature of hematopoiesis in GATA2 deficiency Wu et al.32 GEO: GSE135194 Gata2a ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayex press Cebpa ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayexpress DnaseI ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayexpress Gata2 ChIP-Seq Sanchéz-Castillo et al.34 GEO:GSM552234 https://www.ncbi.nlm.nih.gov/geo/ H3K27AC ChIPseq Sanchéz-Castillo et al.34 GEO:GSM1329815 https://www.ncbi.nlm.nih.gov/geo/ H3K4me1 ChIp-Seq Sanchéz-Castillo et al.34 GEO:GSE47085 https://www.ncbi.nlm.nih.gov/geo/ Analysis code This study https://zenodo.org/badge/latestdoi/595093929 Experimental models: Cell lines HPC-7 Pinto do Ó et al.48 RRID:CVCL_RB19 Experimental models: Organisms/strains zebrafish Tg(-6.0itga2b:EGFP)la2Tg Li et al.63 N/A Zebrafish Tg(gata1a:DsRed)sd2Tg Traver et al.64 N/A Zebrafish Tg(mpx:GFP)c264Tg Renshaw et al.15 N/A Zebrafish Tg(mpeg1:GFP)gl22 Ellet et al.65 N/A Zebrafish gata2aDi4/Di4 Dobrzycki et al.13 N/A Zebrafish Tg(runx1P2:Citrine)ox1Tg Bonkhofer et al.45 N/A Recombinant DNA GATA2 ORF plasmid Genscript OMu19368D Software and algorithms CellRanger (v3.1.0) 10x Genomics https://www.10xgenomics.com/ Loupe(v6.0) 10x Genomics https://www.10xgenomics.com/; RRID:SCR_018555 Seurat (v4.04) Butler et al.66; Satija et al.67; Stuart et al.68 https://satijalab.org/seurat/index.html; RRID:SCR_007322 Metascape Zhou et al.69 https://metascape.org/gp/index.html Monocle3 Cao et al.70; Levine et al.71; Qiu et al.72; Traag et al.73; Trapnell et al.74 https://cole-trapnell-lab.github.io/monocle3/; RRID:SCR_018685 MACS3 https://github.com/macs3-project/MACS CellRanger ATAC (v1.2.0) 10xGenomics https://www.10xgenomics.com/ Signac (v1.4.0) Stuart et al.75 https://stuartlab.org/signac/; RRID:SCR_021158 (Continued on next page) Cell Reports 42, 112571, June 27, 2023 17 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER HOMER (v4.4) Heinz et al.76 http://homer.ucsd.edu/homer/; RRID:SCR_010881 Java TreeView Saldanha77 https://jtreeview.sourceforge.net/; RRID:SCR_016916 Fiji Schindelin et al.78 https://imagej.net/software/fiji/; RRID:SCR_002285 GraphPad Prism (v9.0) GraphPad software https://www.graphpad.com/ AxioVision software Zeiss https://www.micro-shop.zeiss.com/ en/us/system/axiovision+softwaresoftware+axiovision-software/6014/ Other ISH probe: runx1 Kalev-Zylinska79 N/A ISH probe: mpx Bennett et al.80 N/A ISH probe: cebpa Liu et al.81 N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AA) Sequence: ATAGCCAAGCTTCCCGAAG IDT N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AB Sequence: GAACACATCCACCTCGTCCG IDT N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AC) Sequence: TCTGGTGATACGTCTTTCGG IDT N/A Cas9 protein (Alt-R S.p.

    Recombinant:

    Article Title: Lineage skewing and genome instability underlie marrow failure in a zebrafish model of GATA2 deficiency.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies H2A.XS139ph GeneTex GTX127342; RRID:AB_2833105 Alexa Fluor 594 goat anti-rabbit Invitrogen A11012; RRID:AB_2534079 gH2AX Millipore 05-636; RRID:AB_309864 H2A Millipore 07-146; RRID:AB_310394 GATA2 R&D Systems MAB2046-SP; RRID:AB_2108424 Anti-rabbit HRP Agilent P0399; RRID:AB_2617141 Anti-goat HRP Agilent P0449; RRID:AB_2617143 Anti-Mouse HRP Agilent P0447; RRID:AB_2617137 Anti-Digoxigenin-AP Roche 11093274910; RRID:AB_514497 Chemicals, peptides, and recombinant proteins StemPro-34 SFM Invitrogen 10639011 Pen/Strep Gibco 15140122 L-glutamine Gibco 25030081 SCF Peprotech 250-03 pan-GATA inhibitor pyrrothiogatain Generon AOB13027-5 NPM1 oligomerization inhibitor NSC348884 Selleck Chemicals S8149-SEL superfrost plus slide Thermo Scientific 12372098 May-Gr€unwald Sigma MG500 Giemsa stain, modified solution Sigma-Aldrich 48900-1L-F DPX Sigma-Aldrich 44581 trypan blue Sigma-Aldrich T6146 FCS Gibco 26140079 Hoechst’s Invitrogen 11534886 PFA Thermo Scientific 28908 Triton Alfa Aesar A16046 NaCl Sigma 101856436 MgCl2 Sigma 102111007 sucrose Sigma 102192646 PIPES Alfa Aesar J63234 DAPI abcam ab104139 DraIII NEB R3510 mMESSAGE mMACHINETM T7 Transcription Kit Thermofisher AM1344 TE buffer (Tris-HCL and EDTA) Trizma base EDTA Sigma-Aldrich Sigma-Aldrich T1503 E6758 Ethanol VWR 20821 20x SSC BioRad 1610775 BM Purple AP Stain Roche 11442074001 Blocking Reagent Roche 11096176001 Formamide VWR 24311.291 Tween 20 Sigma-Aldrich P2287 Sodium Chloride J.T.Baker 15368426 Maleic Acid Sigma-Aldrich M0375 Magnesium Chloride Sigma-Aldrich M9272 Hydrogen Peroxide J.T.Baker 15587984 (Continued on next page) 16 Cell Reports 42, 112571, June 27, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 10x PBS Gibco 14200-067 Citric Acid Sigma-Aldrich C0759 Torula RNA Sigma-Aldrich R6875 Heparin Sigma-Aldrich H3400 DMSO Sigma-Aldrich D2650 Tricaine Sigma-Aldrich E10521 Methylcellulose Sigma-Aldrich M0387 Deposited data RAW and analyzed data This paper GEO: GSE200503 scRNA-Seq: Single-cell RNA-seq reveals a distinct transcriptome signature of hematopoiesis in GATA2 deficiency Wu et al.32 GEO: GSE135194 Gata2a ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayex press Cebpa ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayexpress DnaseI ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayexpress Gata2 ChIP-Seq Sanchéz-Castillo et al.34 GEO:GSM552234 https://www.ncbi.nlm.nih.gov/geo/ H3K27AC ChIPseq Sanchéz-Castillo et al.34 GEO:GSM1329815 https://www.ncbi.nlm.nih.gov/geo/ H3K4me1 ChIp-Seq Sanchéz-Castillo et al.34 GEO:GSE47085 https://www.ncbi.nlm.nih.gov/geo/ Analysis code This study https://zenodo.org/badge/latestdoi/595093929 Experimental models: Cell lines HPC-7 Pinto do Ó et al.48 RRID:CVCL_RB19 Experimental models: Organisms/strains zebrafish Tg(-6.0itga2b:EGFP)la2Tg Li et al.63 N/A Zebrafish Tg(gata1a:DsRed)sd2Tg Traver et al.64 N/A Zebrafish Tg(mpx:GFP)c264Tg Renshaw et al.15 N/A Zebrafish Tg(mpeg1:GFP)gl22 Ellet et al.65 N/A Zebrafish gata2aDi4/Di4 Dobrzycki et al.13 N/A Zebrafish Tg(runx1P2:Citrine)ox1Tg Bonkhofer et al.45 N/A Recombinant DNA GATA2 ORF plasmid Genscript OMu19368D Software and algorithms CellRanger (v3.1.0) 10x Genomics https://www.10xgenomics.com/ Loupe(v6.0) 10x Genomics https://www.10xgenomics.com/; RRID:SCR_018555 Seurat (v4.04) Butler et al.66; Satija et al.67; Stuart et al.68 https://satijalab.org/seurat/index.html; RRID:SCR_007322 Metascape Zhou et al.69 https://metascape.org/gp/index.html Monocle3 Cao et al.70; Levine et al.71; Qiu et al.72; Traag et al.73; Trapnell et al.74 https://cole-trapnell-lab.github.io/monocle3/; RRID:SCR_018685 MACS3 https://github.com/macs3-project/MACS CellRanger ATAC (v1.2.0) 10xGenomics https://www.10xgenomics.com/ Signac (v1.4.0) Stuart et al.75 https://stuartlab.org/signac/; RRID:SCR_021158 (Continued on next page) Cell Reports 42, 112571, June 27, 2023 17 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER HOMER (v4.4) Heinz et al.76 http://homer.ucsd.edu/homer/; RRID:SCR_010881 Java TreeView Saldanha77 https://jtreeview.sourceforge.net/; RRID:SCR_016916 Fiji Schindelin et al.78 https://imagej.net/software/fiji/; RRID:SCR_002285 GraphPad Prism (v9.0) GraphPad software https://www.graphpad.com/ AxioVision software Zeiss https://www.micro-shop.zeiss.com/ en/us/system/axiovision+softwaresoftware+axiovision-software/6014/ Other ISH probe: runx1 Kalev-Zylinska79 N/A ISH probe: mpx Bennett et al.80 N/A ISH probe: cebpa Liu et al.81 N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AA) Sequence: ATAGCCAAGCTTCCCGAAG IDT N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AB Sequence: GAACACATCCACCTCGTCCG IDT N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AC) Sequence: TCTGGTGATACGTCTTTCGG IDT N/A Cas9 protein (Alt-R S.p.

    Plasmid Preparation:

    Article Title: Lineage skewing and genome instability underlie marrow failure in a zebrafish model of GATA2 deficiency.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies H2A.XS139ph GeneTex GTX127342; RRID:AB_2833105 Alexa Fluor 594 goat anti-rabbit Invitrogen A11012; RRID:AB_2534079 gH2AX Millipore 05-636; RRID:AB_309864 H2A Millipore 07-146; RRID:AB_310394 GATA2 R&D Systems MAB2046-SP; RRID:AB_2108424 Anti-rabbit HRP Agilent P0399; RRID:AB_2617141 Anti-goat HRP Agilent P0449; RRID:AB_2617143 Anti-Mouse HRP Agilent P0447; RRID:AB_2617137 Anti-Digoxigenin-AP Roche 11093274910; RRID:AB_514497 Chemicals, peptides, and recombinant proteins StemPro-34 SFM Invitrogen 10639011 Pen/Strep Gibco 15140122 L-glutamine Gibco 25030081 SCF Peprotech 250-03 pan-GATA inhibitor pyrrothiogatain Generon AOB13027-5 NPM1 oligomerization inhibitor NSC348884 Selleck Chemicals S8149-SEL superfrost plus slide Thermo Scientific 12372098 May-Gr€unwald Sigma MG500 Giemsa stain, modified solution Sigma-Aldrich 48900-1L-F DPX Sigma-Aldrich 44581 trypan blue Sigma-Aldrich T6146 FCS Gibco 26140079 Hoechst’s Invitrogen 11534886 PFA Thermo Scientific 28908 Triton Alfa Aesar A16046 NaCl Sigma 101856436 MgCl2 Sigma 102111007 sucrose Sigma 102192646 PIPES Alfa Aesar J63234 DAPI abcam ab104139 DraIII NEB R3510 mMESSAGE mMACHINETM T7 Transcription Kit Thermofisher AM1344 TE buffer (Tris-HCL and EDTA) Trizma base EDTA Sigma-Aldrich Sigma-Aldrich T1503 E6758 Ethanol VWR 20821 20x SSC BioRad 1610775 BM Purple AP Stain Roche 11442074001 Blocking Reagent Roche 11096176001 Formamide VWR 24311.291 Tween 20 Sigma-Aldrich P2287 Sodium Chloride J.T.Baker 15368426 Maleic Acid Sigma-Aldrich M0375 Magnesium Chloride Sigma-Aldrich M9272 Hydrogen Peroxide J.T.Baker 15587984 (Continued on next page) 16 Cell Reports 42, 112571, June 27, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 10x PBS Gibco 14200-067 Citric Acid Sigma-Aldrich C0759 Torula RNA Sigma-Aldrich R6875 Heparin Sigma-Aldrich H3400 DMSO Sigma-Aldrich D2650 Tricaine Sigma-Aldrich E10521 Methylcellulose Sigma-Aldrich M0387 Deposited data RAW and analyzed data This paper GEO: GSE200503 scRNA-Seq: Single-cell RNA-seq reveals a distinct transcriptome signature of hematopoiesis in GATA2 deficiency Wu et al.32 GEO: GSE135194 Gata2a ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayex press Cebpa ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayexpress DnaseI ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayexpress Gata2 ChIP-Seq Sanchéz-Castillo et al.34 GEO:GSM552234 https://www.ncbi.nlm.nih.gov/geo/ H3K27AC ChIPseq Sanchéz-Castillo et al.34 GEO:GSM1329815 https://www.ncbi.nlm.nih.gov/geo/ H3K4me1 ChIp-Seq Sanchéz-Castillo et al.34 GEO:GSE47085 https://www.ncbi.nlm.nih.gov/geo/ Analysis code This study https://zenodo.org/badge/latestdoi/595093929 Experimental models: Cell lines HPC-7 Pinto do Ó et al.48 RRID:CVCL_RB19 Experimental models: Organisms/strains zebrafish Tg(-6.0itga2b:EGFP)la2Tg Li et al.63 N/A Zebrafish Tg(gata1a:DsRed)sd2Tg Traver et al.64 N/A Zebrafish Tg(mpx:GFP)c264Tg Renshaw et al.15 N/A Zebrafish Tg(mpeg1:GFP)gl22 Ellet et al.65 N/A Zebrafish gata2aDi4/Di4 Dobrzycki et al.13 N/A Zebrafish Tg(runx1P2:Citrine)ox1Tg Bonkhofer et al.45 N/A Recombinant DNA GATA2 ORF plasmid Genscript OMu19368D Software and algorithms CellRanger (v3.1.0) 10x Genomics https://www.10xgenomics.com/ Loupe(v6.0) 10x Genomics https://www.10xgenomics.com/; RRID:SCR_018555 Seurat (v4.04) Butler et al.66; Satija et al.67; Stuart et al.68 https://satijalab.org/seurat/index.html; RRID:SCR_007322 Metascape Zhou et al.69 https://metascape.org/gp/index.html Monocle3 Cao et al.70; Levine et al.71; Qiu et al.72; Traag et al.73; Trapnell et al.74 https://cole-trapnell-lab.github.io/monocle3/; RRID:SCR_018685 MACS3 https://github.com/macs3-project/MACS CellRanger ATAC (v1.2.0) 10xGenomics https://www.10xgenomics.com/ Signac (v1.4.0) Stuart et al.75 https://stuartlab.org/signac/; RRID:SCR_021158 (Continued on next page) Cell Reports 42, 112571, June 27, 2023 17 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER HOMER (v4.4) Heinz et al.76 http://homer.ucsd.edu/homer/; RRID:SCR_010881 Java TreeView Saldanha77 https://jtreeview.sourceforge.net/; RRID:SCR_016916 Fiji Schindelin et al.78 https://imagej.net/software/fiji/; RRID:SCR_002285 GraphPad Prism (v9.0) GraphPad software https://www.graphpad.com/ AxioVision software Zeiss https://www.micro-shop.zeiss.com/ en/us/system/axiovision+softwaresoftware+axiovision-software/6014/ Other ISH probe: runx1 Kalev-Zylinska79 N/A ISH probe: mpx Bennett et al.80 N/A ISH probe: cebpa Liu et al.81 N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AA) Sequence: ATAGCCAAGCTTCCCGAAG IDT N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AB Sequence: GAACACATCCACCTCGTCCG IDT N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AC) Sequence: TCTGGTGATACGTCTTTCGG IDT N/A Cas9 protein (Alt-R S.p.

    Software:

    Article Title: Lineage skewing and genome instability underlie marrow failure in a zebrafish model of GATA2 deficiency.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies H2A.XS139ph GeneTex GTX127342; RRID:AB_2833105 Alexa Fluor 594 goat anti-rabbit Invitrogen A11012; RRID:AB_2534079 gH2AX Millipore 05-636; RRID:AB_309864 H2A Millipore 07-146; RRID:AB_310394 GATA2 R&D Systems MAB2046-SP; RRID:AB_2108424 Anti-rabbit HRP Agilent P0399; RRID:AB_2617141 Anti-goat HRP Agilent P0449; RRID:AB_2617143 Anti-Mouse HRP Agilent P0447; RRID:AB_2617137 Anti-Digoxigenin-AP Roche 11093274910; RRID:AB_514497 Chemicals, peptides, and recombinant proteins StemPro-34 SFM Invitrogen 10639011 Pen/Strep Gibco 15140122 L-glutamine Gibco 25030081 SCF Peprotech 250-03 pan-GATA inhibitor pyrrothiogatain Generon AOB13027-5 NPM1 oligomerization inhibitor NSC348884 Selleck Chemicals S8149-SEL superfrost plus slide Thermo Scientific 12372098 May-Gr€unwald Sigma MG500 Giemsa stain, modified solution Sigma-Aldrich 48900-1L-F DPX Sigma-Aldrich 44581 trypan blue Sigma-Aldrich T6146 FCS Gibco 26140079 Hoechst’s Invitrogen 11534886 PFA Thermo Scientific 28908 Triton Alfa Aesar A16046 NaCl Sigma 101856436 MgCl2 Sigma 102111007 sucrose Sigma 102192646 PIPES Alfa Aesar J63234 DAPI abcam ab104139 DraIII NEB R3510 mMESSAGE mMACHINETM T7 Transcription Kit Thermofisher AM1344 TE buffer (Tris-HCL and EDTA) Trizma base EDTA Sigma-Aldrich Sigma-Aldrich T1503 E6758 Ethanol VWR 20821 20x SSC BioRad 1610775 BM Purple AP Stain Roche 11442074001 Blocking Reagent Roche 11096176001 Formamide VWR 24311.291 Tween 20 Sigma-Aldrich P2287 Sodium Chloride J.T.Baker 15368426 Maleic Acid Sigma-Aldrich M0375 Magnesium Chloride Sigma-Aldrich M9272 Hydrogen Peroxide J.T.Baker 15587984 (Continued on next page) 16 Cell Reports 42, 112571, June 27, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 10x PBS Gibco 14200-067 Citric Acid Sigma-Aldrich C0759 Torula RNA Sigma-Aldrich R6875 Heparin Sigma-Aldrich H3400 DMSO Sigma-Aldrich D2650 Tricaine Sigma-Aldrich E10521 Methylcellulose Sigma-Aldrich M0387 Deposited data RAW and analyzed data This paper GEO: GSE200503 scRNA-Seq: Single-cell RNA-seq reveals a distinct transcriptome signature of hematopoiesis in GATA2 deficiency Wu et al.32 GEO: GSE135194 Gata2a ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayex press Cebpa ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayexpress DnaseI ChIP-Seq (ArrayExpress) Sanchéz-Castillo et al.34 BioStudies: E-MATB-3954 https://www.ebi.ac.uk/biostudies/arrayexpress Gata2 ChIP-Seq Sanchéz-Castillo et al.34 GEO:GSM552234 https://www.ncbi.nlm.nih.gov/geo/ H3K27AC ChIPseq Sanchéz-Castillo et al.34 GEO:GSM1329815 https://www.ncbi.nlm.nih.gov/geo/ H3K4me1 ChIp-Seq Sanchéz-Castillo et al.34 GEO:GSE47085 https://www.ncbi.nlm.nih.gov/geo/ Analysis code This study https://zenodo.org/badge/latestdoi/595093929 Experimental models: Cell lines HPC-7 Pinto do Ó et al.48 RRID:CVCL_RB19 Experimental models: Organisms/strains zebrafish Tg(-6.0itga2b:EGFP)la2Tg Li et al.63 N/A Zebrafish Tg(gata1a:DsRed)sd2Tg Traver et al.64 N/A Zebrafish Tg(mpx:GFP)c264Tg Renshaw et al.15 N/A Zebrafish Tg(mpeg1:GFP)gl22 Ellet et al.65 N/A Zebrafish gata2aDi4/Di4 Dobrzycki et al.13 N/A Zebrafish Tg(runx1P2:Citrine)ox1Tg Bonkhofer et al.45 N/A Recombinant DNA GATA2 ORF plasmid Genscript OMu19368D Software and algorithms CellRanger (v3.1.0) 10x Genomics https://www.10xgenomics.com/ Loupe(v6.0) 10x Genomics https://www.10xgenomics.com/; RRID:SCR_018555 Seurat (v4.04) Butler et al.66; Satija et al.67; Stuart et al.68 https://satijalab.org/seurat/index.html; RRID:SCR_007322 Metascape Zhou et al.69 https://metascape.org/gp/index.html Monocle3 Cao et al.70; Levine et al.71; Qiu et al.72; Traag et al.73; Trapnell et al.74 https://cole-trapnell-lab.github.io/monocle3/; RRID:SCR_018685 MACS3 https://github.com/macs3-project/MACS CellRanger ATAC (v1.2.0) 10xGenomics https://www.10xgenomics.com/ Signac (v1.4.0) Stuart et al.75 https://stuartlab.org/signac/; RRID:SCR_021158 (Continued on next page) Cell Reports 42, 112571, June 27, 2023 17 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER HOMER (v4.4) Heinz et al.76 http://homer.ucsd.edu/homer/; RRID:SCR_010881 Java TreeView Saldanha77 https://jtreeview.sourceforge.net/; RRID:SCR_016916 Fiji Schindelin et al.78 https://imagej.net/software/fiji/; RRID:SCR_002285 GraphPad Prism (v9.0) GraphPad software https://www.graphpad.com/ AxioVision software Zeiss https://www.micro-shop.zeiss.com/ en/us/system/axiovision+softwaresoftware+axiovision-software/6014/ Other ISH probe: runx1 Kalev-Zylinska79 N/A ISH probe: mpx Bennett et al.80 N/A ISH probe: cebpa Liu et al.81 N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AA) Sequence: ATAGCCAAGCTTCCCGAAG IDT N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AB Sequence: GAACACATCCACCTCGTCCG IDT N/A crRNAs for gata2a (Dr.Cas9.GATA2A.AC) Sequence: TCTGGTGATACGTCTTTCGG IDT N/A Cas9 protein (Alt-R S.p.



    Similar Products

    algorithms cellranger suite  (10X Genomics)
    86
    10X Genomics algorithms cellranger suite
    Algorithms Cellranger Suite, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+cellranger/10x+cellranger+genomics+suite/pm42167232-241-47-51
    Average 86 stars, based on 1 article reviews
    algorithms cellranger suite - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms cellranger v4 0 0 10x genomics rrid scr 0173 r  (10X Genomics)
    86
    10X Genomics algorithms cellranger v4 0 0 10x genomics rrid scr 0173 r
    Algorithms Cellranger V4 0 0 10x Genomics Rrid Scr 0173 R, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+cellranger/cellranger/10__1016_slash_j__isci__2026__115730-171-256-259
    Average 86 stars, based on 1 article reviews
    algorithms cellranger v4 0 0 10x genomics rrid scr 0173 r - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    software and algorithms cellranger 10x genomics  (10X Genomics)
    90
    10X Genomics software and algorithms cellranger 10x genomics
    Software And Algorithms Cellranger 10x Genomics, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+cellranger/10x+genomics+cell+ranger+pipeline/pm40531616-570-209-214
    Average 90 stars, based on 1 article reviews
    software and algorithms cellranger 10x genomics - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    algorithms zeiss zen 3 0 sr software carl zeiss n a bitplane imaris oxford instruments n a cellranger toolkit  (Carl Zeiss)
    93
    Carl Zeiss algorithms zeiss zen 3 0 sr software carl zeiss n a bitplane imaris oxford instruments n a cellranger toolkit
    Algorithms Zeiss Zen 3 0 Sr Software Carl Zeiss N A Bitplane Imaris Oxford Instruments N A Cellranger Toolkit, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+cellranger/pm40315055-170-188-194
    Average 93 stars, based on 1 article reviews
    algorithms zeiss zen 3 0 sr software carl zeiss n a bitplane imaris oxford instruments n a cellranger toolkit - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    cellranger v6.0.1 ‘count’ algorithm  (10X Genomics)
    90
    10X Genomics cellranger v6.0.1 ‘count’ algorithm
    Cellranger V6.0.1 ‘Count’ Algorithm, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+cellranger/cellranger/pmc11483560-313-8-8
    Average 90 stars, based on 1 article reviews
    cellranger v6.0.1 ‘count’ algorithm - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    algorithms cellranger 10x genomics  (10X Genomics)
    86
    10X Genomics algorithms cellranger 10x genomics
    Algorithms Cellranger 10x Genomics, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+cellranger/cellranger/pm39406231-173-7-9
    Average 86 stars, based on 1 article reviews
    algorithms cellranger 10x genomics - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    cellranger arc v2 0 0 count algorithm  (10X Genomics)
    86
    10X Genomics cellranger arc v2 0 0 count algorithm
    Cellranger Arc V2 0 0 Count Algorithm, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+cellranger/cellranger/pm38862028-495-16-21
    Average 86 stars, based on 1 article reviews
    cellranger arc v2 0 0 count algorithm - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms cellranger 10x genomics v4 0 0 cellbender fleming  (Addgene inc)
    93
    Addgene inc algorithms cellranger 10x genomics v4 0 0 cellbender fleming
    Algorithms Cellranger 10x Genomics V4 0 0 Cellbender Fleming, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+cellranger/pAAV-CA+(Plasmid+%2369616)/pm39084216-599-104-101
    Average 93 stars, based on 1 article reviews
    algorithms cellranger 10x genomics v4 0 0 cellbender fleming - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    algorithms cellranger v3 0 2  (10X Genomics)
    86
    10X Genomics algorithms cellranger v3 0 2
    Algorithms Cellranger V3 0 2, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+cellranger/cellranger/pm38761373-1019-5-11
    Average 86 stars, based on 1 article reviews
    algorithms cellranger v3 0 2 - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier

    Image Search Results